³Ô¹ÏÍø

Make scientific figures in minutes

Create publication-quality figures with pre-made icons and templates, all from ³Ô¹ÏÍø's web-based scientific illustration software

search icon

Try a synonym, or to request an icon from the app.

Telomere

Telomere - Editable icon of Telomere
[]
Keywords
DNA (2D, squiggle 3),DNA (2D, squiggle 2),DNA replication (2D, fork),TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG,AATCCCAATCCCAATCCC,3',5',Chromosome (with telomeres 1)

Join 1,500,000 other scientists on ³Ô¹ÏÍø

Sign up for your free account and start creating scientific figures faster today
Decorative Chat Icon

FAQ

What is ³Ô¹ÏÍø?
³Ô¹ÏÍø is a web-based software that helps you create scientific figures in minutes. Our program has a library of more than 30,000 life science icons, as well as drag-and-drop functionality to help you make professional figures quickly.
How can I use this icon?
You can use this icon and thousands more by signing up for a ³Ô¹ÏÍø account at https://app.biorender.com
I want a variation of this icon. How do I know if it's available?
You can browse our library by typing in the search bar above or sign up for ³Ô¹ÏÍø and search in the app. Can't find an icon? Premium users can request custom icons and we'll make them in as little as 48 hours.
Where can I use figures I make with this icon?
Figures made in ³Ô¹ÏÍø can always be used for educational use. If you'd like to use a figure for a publication, you must be registered for a premium plan. You can find more details on our pricing page
I have other questions. How do I contact support?
You can contact us anytime at support@biorender.com. We aim to get back to all requests within 24 hours.

Looking for science content?

Browse 50K+ icons and templates that are peer-reviewed, easy to use, and free.